v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) SOCS2 antisense RNA 1 (SOCS2-AS1) URS000075B390_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SOCS2-AS1: SOCS2-AS1 is a long non-coding RNA (lncRNA) that has been studied in various contexts. One study found that the level of exosomal SOCS2-AS1 was inversely associated with the severity of atherosclerosis, indicating its potential role in this condition [PMC7171639]. Another study demonstrated that SOCS2-AS1 acts as a tumor suppressor by promoting the degradation of AURKA protein, which is involved in cancer cell growth [PMC8024384]. Additionally, it was observed that SOCS2-AS1 is positively correlated with the expression of SOCS2 in colorectal cancer (CRC) tissues [PMC7346041]. This suggests that SOCS2-AS1 may play a role in promoting CRC progression by facilitating the expression of SOCS2 through miR-1264 sponging [PMC7346041]. Furthermore, it has been reported that SOCS2-AS1 is an androgen-induced lncRNA that promotes cell growth and migration potential in prostate cancer (PCa) cells [PMC6084828]. In a broader context, several lncRNAs, including TMPO-AS1, LINC00304, PRCAT38, ARLNC1, GAS5, SOCS2-AS1, and ZEB1-AS1 have been identified as targets of AR (androgen receptor) in various cancer types [PMC7988692]. These findings highlight the diverse roles and potential clinical significance of SOCS2-AS1 across different diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAAGCAGGCAGCAACGCUAGGCCGCGGGGCAGAGCCGCGGUUCGGACUCUCUCUUCCCCGGCGCUCCGAGCUGCGGAAGCCCAGGCCGUCCGCCGCUCCCCGGCGCACGCGGCCGCGCCUCGCCGCCCUCCCCGAGUUUGCCAUCUCCGUACCACCACCACCACCACACACAGCACCCUCAAGACUCCCUGUGAUCCUGGGAUGCACUCAACGAAGAGUGUGUGGCCCAGGAUUUGAUGGAAAUGCUACAAGAGAAGCAGGCUCUCCCCUUCUGAAAUGAUGAGUGAUAAUGACCAUACAGGUCAACUUUUCCACCACUUGGAGGGAGCCUGUCAAAGAACAAAGGCAACAGAGAAGAGAGCAGAGCUGAGGUUGGGUGAGAGGGAGAAAUUCCUGAGUGCUUGAAUCCCACAUGCCGGAAGCCGCACCACACUUGGACUUCUCAAUACAGGAGCCACUCUGCAGGCAUUUAUUGGCAGGCUACACCUAAGACUUUCUCUGCAGAAAAAUGUUCUAGAUGCACAGAUUUGGGGGCUUGAUUGACAACCUGACACCUCACUCUAAAUCCGCAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications