v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 6762 (ENSRROG00000025941.1) URS000075B2A2_61622

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAGCCGGGGCCAUGGAGCAGCCUGUGUAGACGGGGACCUGCCCUGCAUGGGCACCCCCUCACUGGCUGCUUCCCUUGGUCUCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Colobus angolensis palliatus miRNA (ENSCANG00000008840.1)
  2. Gorilla gorilla gorilla microRNA 6762 (ENSGGOG00000039620.1)
  3. Homo sapiens microRNA hsa-mir-6762 precursor
  4. Rhinopithecus bieti microRNA 6762 (ENSRBIG00000019852.1)