v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2384 (LINC02384) URS000075B0EC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02384: LINC02384 is a long non-coding RNA (lncRNA) that has been implicated in various biological processes and diseases. It is part of a 12-FRLncRNA signature that can accurately predict the prognosis of patients with breast cancer (BC) [PMC8521053]. In this signature, LINC02384 is associated with high-risk FRLncRNAs [PMC8521053]. Additionally, LINC02384 is highly expressed in low-risk groups, indicating that it is a low-risk FRLncRNA [PMC8521053]. In the context of renal cell carcinoma (RCC), LINC02384 is one of the nine lncRNAs used to construct a prognostic model for patients with high stage and grade RCC [PMC8806408]. It has the potential to predict prognosis in these patients [PMC8806408]. Furthermore, LINC02384 has been implicated in immune-related processes. It acts as a competing endogenous RNA (ceRNA) for IL2RA and IL7R, potentially promoting oncogenesis [PMC8290234]. Additionally, it has been found to be up-regulated in patients with Sjögren's syndrome (SS), along with other lncRNAs such as LINC00426-003 and AC017002.1 [PMC8230573] [PMC9368403]. Overall, LINC02384 plays various roles in different diseases and biological processes. It can be used as a prognostic marker for BC and RCC patients and may have implications in immune-related disorders such as SS.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAGAGGCUGUGGCAAGGGUCCAUGCCUGAAUGUGUAGAACAAGAACAGCUGGAGGCUGUGGCUUUCUCCAGGAAGAGGUUUCUAAAUCUGCCUCUUAGAAGAUAUCAGAAAGUUAAAGUUUCUCUUGCUGCCGCCGUGUAAGAAGGACCUUUUGCCUCCCACCAUGAUUCUAAGUCCUCCCCAGCCACGUGGAACUGCUUUCAUUUGGUCUCUUUUCGAAUCAGAAGACCCAGAAAACUUGGAUCCACUUCUGGCUCUCAUCCCUCUGGGCAGUGUGAUUUGGAUUGAGCAGAUGCUCCGGCUGCCACUCCAUCAUAUAUUGGAAACAGCAUUACUUUAUAGUAAAUCAUGACCACGGUGUAUGGCAAUGAAGUUGCAUCUGAAGCAGCCGGCACCCUAUGUGCUAGCUGGCUUUUAGACCAGGAGACUGUGAAUCUGUGGUCAGGAUCUCUUUAGGGCUGCUAAAUAUAUACUACCCACUAUCACUCGCUGGAGCUGCAGACCCUAGUUUUAGAGUUUCACUUCUUAAAGACCUUCAUCCUUAUUAAAAUGGUAAUAUCCUUACUGUCAUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications