Denticeps clupeoides (denticle herring) microRNA 301a (ENSDCDG00000002038.1, ENSDCDG00000012845.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Denticeps clupeoides (denticle herring) microRNA 301a (ENSDCDG00000002038.1, ENSDCDG00000012845.1) URS000075B073_299321

86 nucleotides
1 database (Ensembl)
Found in 3 other species
44 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GCUGUUAACAGGUGCUCUGACUUCAUUGCACUACUGUAUUGGACAGCUAGCAGUGCAAUAGUAUUGUCAAAGCGUCUGAGAGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Danio rerio microRNA dre-mir-301a precursor
Sinocyclocheilus anshuiensis miRNA (ENSSANG00000022411.1)
Sinocyclocheilus rhinocerous miRNA (ENSSRHG00000037326.1)

Publications