Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-645 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-645 precursor URS000075AEA1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-645: Hsa-mir-645 is a significantly downregulated miRNA [PMC7292968]. It is one of the miRNAs that negatively regulate four specific genes [PMC9650865]. Hsa-mir-645 is predicted to be a "Moderate Target" of COL4A4 [PMC9498445]. It has the potential to regulate the post-transcriptional level of hub CORGs in COVID-19 and MI [PMC10067640]. Hsa-mir-645 is downregulated in COVID-19 and MI [PMC6942769]. It is significantly associated with rs11089328 (DGCR8) in differential tissue expression under the dominant genotype [PMC4841949]. Hsa-mir-645 was not profiled in certain signatures, including signatures D, C, CB [PMC4519802]. The seed sequence of hsa-mir-645 was identified within the endo-siRNA derived from RMRP [PMC3676784]. However, hsa-mir-645 was not detected in certain cell types, unlike hsa-miR-1224-5p which was detected in all cell types [PMC3676784]. References: [PMC7292968] [PMC9650865] [PMC9498445] [PMC10067640] [PMC6942769] [PMC4841949] [PM4519802] [PM3676784]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUUCCUAACAGGCCUCAGACCAGUACCGGUCUGUGGCCUGGGGGUUGAGGACCCCUGCUCUAGGCUGGUACUGCUGAUGCUUAAAAAGAGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

2D structure Publications