Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-645 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-645 precursor URS000075AEA1_9606

  • 94 nucleotides
  • 5 databases (Ensembl, GeneCards, HUGO Gene Nomenclature Committee, MIRBASE, RefSeq)
  • Found in 1 other species
  • 64 publications
  • pre_miRNA
Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-645: hsa-mir-645 is a microRNA (miRNA) that has been identified as significantly downregulated in certain biological contexts [PMC7292968]. It is among the miRNAs that negatively regulate specific genes, suggesting a potential role in gene expression modulation [PMC9650865]. Despite being predicted as a "Moderate Target" for gene COL4A4, the consistency of this prediction with the change in stability (∆S) indicates a potential functional interaction [PMC9498445]. In studies related to COVID-19 and myocardial infarction (MI), hsa-mir-645 has been highlighted as one of the miRNAs that could regulate the post-transcriptional level of hub central obesity-related genes (CORGs), warranting further investigation [PMC10067640]. Additionally, hsa-mir-645 was found to be downregulated in certain studies, suggesting its involvement in disease-related expression profiles [PMC6942769], and was significantly associated with rs11089328 (DGCR8) under the dominant genotype, indicating its relevance to differential tissue expression [PMC4841949]. The miRNA was not profiled in some studies, which could imply its selective expression or relevance under specific conditions or disease states [PMC4519802]. The seed sequence of hsa-mir-645 has been identified within endo-siRNAs derived from RMRP, and its quantification is possible through established real-time PCR protocols [PMC3676784], although it was not detected across all cell types examined [PMC3676784].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUUCCUAACAGGCCUCAGACCAGUACCGGUCUGUGGCCUGGGGGUUGAGGACCCCUGCUCUAGGCUGGUACUGCUGAUGCUUAAAAAGAGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression Publications