v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) CHODL antisense RNA 1 (CHODL-AS1) URS000075AD2B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CHODL-AS1: CHODL-AS1 is a long non-coding RNA (lncRNA) that has been found to be related to overall survival (OS) in lung adenocarcinoma (LUAD) patients [PMC8798056]. It is one of the 24 lncRNAs identified in a study that analyzed the prognostic immune-related lncRNAs in LUAD [PMC8904995]. CHODL-AS1, along with other uncharacterized lncRNAs, such as FAM182A, SNHG12, and AL772363.1, requires further investigation in cutaneous squamous cell carcinoma (cSCC) [PMC7046790]. In the training set of the study, CHODL-AS1 was one of the 10 lncRNAs with non-zero coefficients determined through multivariate Cox regression analysis [PMC8044985]. The expression levels of CHODL-AS1 were found to be high in LUAD cell lines [PMC8044985]. Additionally, CHODL-AS1 was highly expressed in LUAD cell lines along with other lncRNAs like LINC02535 and LINC01878 [PMC8044985]. In summary, CHODL-AS1 is a type of long non-coding RNA that has been identified as being related to overall survival in lung adenocarcinoma patients. It has also been found to be highly expressed in LUAD cell lines. However, further investigation is needed to understand its role and significance in cutaneous squamous cell carcinoma.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGGAGACAAUCUUGAUAGGAAGUUUGAACUUUGAAAUAAUAUUUUAUUCUACCACCCAUCUAAAGGCUAAUUAAUCACAAAUGUUAAACCAAUCAGAAGAAAAUGUUUGUUAAACCAGAAAAGGCUGUUACCUCUCACAGACAAGUUUCUUUCUUUAGGUCAACAUAUCUGGUGUAGCUGUCAGGAUUCAGAGCAACCUCCUCACACCCUGGACCACCUAGUGAUCCCUCCUGGACUCAGCACUCAGCACCAGCACAAACCUACUGUGUUUCUCUGUCUCCACAUCUUUCCCUGAGUACAAAAGGUAGCCCUGCGUGAGUAGGCAUCUUCCAUCAUCAGAGAUCUCCAACUGAAGCUGACCUGCAGCCAGUCACCUGGUUCUUCAGACCAGGACAAGAAAUUGAAACUCAGUUUAAAAAGAUCACUCAAAAGGCUAAAUGGCUACAAGAUGACCCAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications