Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 760 (ENSGGOG00000031977.2) secondary structure diagram

Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 760 (ENSGGOG00000031977.2) URS000075ABEC_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCGCGUCGCCCCCCUCAGUCCACCAGAGCCCGGAUACCUCAGAAAUUCGGCUCUGGGUCUGUGGGGAGCGAAAUGCAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Ailuropoda melanoleuca microRNA 760 (ENSAMEG00000020544.2)
  2. Balaenoptera musculus microRNA 760 (ENSBMSG00010001087.1)
  3. Callithrix jacchus (white-tufted-ear marmoset) microRNA 760 (ENSCJAG00000047173.2)
  4. Cebus imitator (Panamanian white-faced capuchin) microRNA 760 (ENSCCAG00000002461.1)
  5. Cercocebus atys microRNA 760 (ENSCATG00000018525.1)
  6. Chlorocebus sabaeus (African green monkey) microRNA 760 (ENSCSAG00000021760.1)
  7. Delphinapterus leucas microRNA 760 (ENSDLEG00000018545.1)
  8. Felis catus (domestic cat) microRNA 760 (ENSFCAG00000043367.1)
  9. Gorilla gorilla (western gorilla) mir-760 microRNA precursor family
  10. Homo sapiens microRNA hsa-mir-760 precursor
  11. Lynx canadensis (Canada lynx) microRNA 760 (ENSLCNG00005011607.1)
  12. Macaca mulatta microRNA mml-mir-760 precursor
  13. Macaca nemestrina (Pig-tailed macaque) microRNA 760 (ENSMNEG00000003072.1)
  14. Monodon monoceros (narwhal) microRNA 760 (ENSMMNG00015008413.1)
  15. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 760 (ENSNLEG00000025338.2)
  16. Oryctolagus cuniculus (rabbit) microRNA 760 (ENSOCUG00000019198.1)
  17. Otolemur garnettii (small-eared galago) microRNA 760 (ENSOGAG00000031585.1)
  18. Ovis aries (sheep) microRNA 760 (ENSOARG00020011944.2)
  19. Panthera leo (lion) microRNA 760 (ENSPLOG00000005937.1)
  20. Pan troglodytes ptr-mir-760 (ENSPTRG00000032238.2)
  21. Papio anubis (Olive baboon) mir-760 microRNA precursor family
  22. Phocoena sinus microRNA 760 (ENSPSNG00000017815.1)
  23. Physeter catodon (sperm whale) microRNA 760 (ENSPCTG00005021882.1)
  24. Rhinopithecus bieti microRNA 760 (ENSRBIG00000009251.1)
  25. Rhinopithecus roxellana microRNA 760 (ENSRROG00000003434.1)
  26. Ictidomys tridecemlineatus Spermophilus tridecemlineatus (thirteen-lined ground squirrel) mir-760 microRNA precursor family
  27. Suricata suricatta miRNA (ENSSSUG00005015422.1, ENSSSUG00005019338.1)
  28. Tursiops truncatus (bottlenosed dolphin) microRNA 760 (ENSTTRG00000021529.1)
  29. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 760 (ENSUTTG00000010496.1)
  30. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015001475.1)
2D structure Publications