v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Macaca fascicularis (Crab-eating macaque) microRNA 4677 (ENSMFAG00000006097.2) secondary structure diagram

Macaca fascicularis (Crab-eating macaque) microRNA 4677 (ENSMFAG00000006097.2) URS000075ABD7_9541

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCAAAGCAGCAAUUGUUCUUUGGUCUUUCAGCCAUGACCUGACCUUCUGUCUGUGAGACCAAAGAACUACUUUGCUUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Cercocebus atys microRNA 4677 (ENSCATG00000012369.1)
  2. Chlorocebus sabaeus (African green monkey) microRNA 4677 (ENSCSAG00000027268.1)
  3. Colobus angolensis palliatus miRNA (ENSCANG00000008624.1)
  4. Gorilla gorilla gorilla microRNA 4677 (ENSGGOG00000036731.1)
  5. Homo sapiens microRNA hsa-mir-4677 precursor
  6. Macaca mulatta microRNA 4677 (ENSMMUG00000042187.2)
  7. Macaca nemestrina (Pig-tailed macaque) microRNA 4677 (ENSMNEG00000016602.1)
  8. Mandrillus leucophaeus (Drill) microRNA 4677 (ENSMLEG00000024125.1)
  9. Pan paniscus (bonobo) microRNA 4677 (ENSPPAG00000018175.1)
  10. Pan troglodytes microRNA 4677 (ENSPTRG00000039770.2)
  11. Papio anubis microRNA 4677 (ENSPANG00000027181.3)
  12. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 4677 (ENSPTEG00000000733.1)
  13. Pongo abelii microRNA 4677 (ENSPPYG00000035496.1)
  14. Rhinopithecus bieti microRNA 4677 (ENSRBIG00000019746.1)
  15. Rhinopithecus roxellana microRNA 4677 (ENSRROG00000013873.1)
  16. Theropithecus gelada (gelada) microRNA 4677 (ENSTGEG00000017200.1)
 2D structure Publications