v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Macaca mulatta (Rhesus monkey) microRNA mml-mir-376c precursor secondary structure diagram

Macaca mulatta (Rhesus monkey) microRNA mml-mir-376c precursor URS000075AAAD_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAAAGGUGGAUAUUCCUUCUAUGUUUAUGUUAUUUAUGGUUAAACAUAGAGGAAAUUCCACGUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Homo sapiens microRNA hsa-mir-376c precursor
  2. Pan troglodytes miRNA
  3. Pongo abelii miRNA
  4. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-376c precursor
 2D structure Publications