Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-615 URS000075AA7E_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-615: ssc-mir-615 is a microRNA that has been identified in several studies as playing a role in various biological processes. In one study, it was found that ssc-mir-615, along with other miRNAs, regulates the differentiation process of subcutaneous adipocytes [PMC8834144]. Another study identified ssc-mir-615 as one of the candidate miRNAs that may be involved in precocious puberty in HZ boars [PMC9622794]. The study also found that ssc-mir-615 is highly expressed in immature HZ boars and targets the SPATA3 gene [PMC9622794]. Additionally, ssc-mir-615 was found to be one of the most down-regulated miRNAs in a comparison between different groups [PMC9622794]. The joint analysis of RNA-Seq data further confirmed the involvement of ssc-mir-615 in regulating precocious sexual maturation traits in HZ boars [PMC9622794]. Overall, these studies highlight the importance of ssc-mir-615 in various biological processes and its potential role as a regulator of gene expression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCGAGCCUGGGUCUCCCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

Publications