v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Otus sunia (Oriental scops-owl) miRNA (ENSOSUG00000011606.1) URS000075A99E_257818

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGGUUUUCCUUUGUGCUUGAUCUAACCAUGUGGUAGAACAAUACAAAUUGAACAUGGUUCUGUCAAGCACCAUGGAAGGCUGCAUACUCCCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Accipiter nisus (Eurasian sparrowhawk) microRNA 218-2 (ENSANIG00000000322.1)
  2. Anas platyrhynchos (mallard) microRNA 218-2 (ENSAPLG00020011860.1)
  3. Anas platyrhynchos platyrhynchos (common mallard) microRNA 218-2 (ENSAPLG00000000388.2)
  4. Anas zonorhyncha (Eastern spot-billed duck) miRNA (ENSAZOG00000016703.1)
  5. Anser brachyrhynchus miRNA (ENSABRG00000019838.1)
  6. Anser cygnoides miRNA (ENSACDG00005006206.1)
  7. Aquila chrysaetos chrysaetos microRNA 218-2 (ENSACCG00020016345.1)
  8. Athene cunicularia (burrowing owl) microRNA 218-2 (ENSACUG00000011532.1)
  9. Bubo bubo (Eurasian eagle-owl) miRNA (ENSBOBG00000007034.1)
  10. Buteo japonicus (eastern buzzard) miRNA (ENSBJAG00000011801.1)
  11. Cairina moschata domestica (muscovy Duck (domestic type)) miRNA (ENSCMMG00000005219.1)
  12. Calidris pugnax miRNA (ENSCPUG00000007404.1)
  13. Calidris pygmaea miRNA (ENSCPGG00000010705.1)
  14. Chrysolophus pictus miRNA (ENSCPIG00010001433.1)
  15. Coturnix japonica (Japanese quail) microRNA 218-2 (ENSCJPG00005008661.1)
  16. Falco tinnunculus miRNA (ENSFTIG00000003795.1)
  17. Gallus gallus microRNA gga-mir-218 precursor (gga-mir-218-2)
  18. Meleagris gallopavo (turkey) microRNA 218-2 (ENSMGAG00000000406.2)
  19. Numida meleagris microRNA 218-2 (ENSNMEG00000015685.1)
  20. Phasianus colchicus microRNA 218-2 (ENSPCLG00000008799.1)
  21. Strix occidentalis caurina miRNA (ENSSOCG00000016685.1)