Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-6860 precursor URS000075A7C9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-6860: Hsa-mir-6860 is a microRNA (miRNA) that has been implicated in various biological processes and diseases. Previous studies have shown that miRNAs, including hsa-mir-6860, play a role in the proliferation, invasion, and metastasis of cancers [PMC6267165]. Hsa-mir-6860 is regulated by IKZF3, a transcription factor that controls the expression of multiple miRNAs [PMC7679428]. Additionally, the conversion of a specific polymorphism (C > T) in the 3'UTR rs2839689 has been predicted to affect miRNA binding sites on H19 and alter the function of hsa-mir-6860 [PMC4558153]. Knock-out experiments have demonstrated that hsa-mir-6860 has a moderate impact on viral replication [PMC8622730]. Hsa-mir-6860 has also been identified as one of the core miRNAs involved in various biological processes [PMC9452934]. Interestingly, there is some discrepancy between different databases regarding the annotation of hsa-mir-6860 as a half-mirtron [PMC6785219]. Furthermore, another polymorphism (rs3741219 A>G) has been shown to affect miRNA target sites for hsa-mir-6860 among others [PMC7062941]. Overall, these findings highlight the importance of hsa-mir-6860 in various biological processes and its potential role as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUAAGCAUUGGGGAGUUUGGAGUCGGUGGGUGGAGCCAAACUGGGCAGGGCUGUGGUGAGUGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes miRNA
Publications