Lytechinus variegatus (green sea urchin) microRNA lva-mir-200 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Lytechinus variegatus (green sea urchin) microRNA lva-mir-200 precursor URS000075A729_7654

81 nucleotides
1 database (miRBase)
Found in 2 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGGUGACAUCAUACUGGACAGCAUUGGACGUGAUUGGAUCGUUCUCUAAUACUGUCUGGUGAUGAUGUUGACACUGGCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Strongylocentrotus purpuratus microRNA spu-mir-200 precursor

2D structure