Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1184 precursor (hsa-mir-1184 1 to 3) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1184 precursor (hsa-mir-1184 1 to 3) URS000075A55D_9606

  • 99 nucleotides
  • 7 databases (Ensembl, GeneCards, HUGO Gene Nomenclature Committee, MalaCards, MIRBASE, RefSeq, RFAM)
  • Found in 16 other species
Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1184: hsa-mir-1184 is a microRNA implicated in various biological processes and diseases. It was identified as one of the microRNAs that may interact with GAPLINC, a long non-coding RNA, and was selected as a superior candidate for further study [PMC5902673]. The expression of hsa-mir-1184 was found to significantly increase in prostatic cancer, suggesting its potential role in cancer biology [PMC5452331]. While hsa-mir-1184 is downregulated in degenerative discs, its exact role in the regulation of genes within the PI3K/AKT signaling pathway, which is associated with these conditions, is not explicitly stated [PMC6896343]. In the context of sepsis in children, hsa-mir-1184 has deregulated flow and has been identified as a potential therapeutic target due to its effects on inflammatory responses and apoptosis [PMC9259025]. Additionally, hsa-mir-1184 has been associated with rheumatoid arthritis (RA) development and may serve as a diagnostic biomarker for distinguishing RA from healthy samples [PMC8889404]. It also shares target genes with hsa-miR-24, suggesting a role in the development of pancreatic cancer (PC) and potential as a therapeutic target [PMC5228663]. Furthermore, it was found that changes in circFLNA expression had no effect on hsa-mir-1184 expression levels, indicating specific regulatory mechanisms [PMC10023616].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUGCAGAACGAGGUGAAGGAGGUGGUUCUGCUCAGCAGUCAACAGUGGCCACAUCUCCACCUGCAGCGACUUGAUGGCUUCCGUGUCCUUUUCGUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression