Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1203 URS000075A53F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1203: Hsa-mir-1203 is a microRNA that has been found to be dysregulated in various types of cancer, including prostate cancer, small cell carcinoma of the esophagus, and esophageal squamous cell carcinoma [PMC6797975]. In a study on seminoma therapy, hsa-mir-1203 was identified as a potential target along with other genes and microRNAs [PMC6797975]. Hsa-mir-1203 was found to be mainly present in neurotypical individuals, while other microRNAs such as hsa-miR-182-5p and hsa-miR-681 were more expressed in both patients and controls [PMC9000903]. In terms of genetic interactions, rs3087918 was found to potentially gain the targets of hsa-mir-1203 while losing the targets of hsa-miR-139-3p and hsa-miR-5091 [PMC7362410]. Hsa-mir-1203 has also been studied in relation to TNFSF4, where it was co-transfected into HEK293T cells along with other microRNA mimics [PMC9571479]. Furthermore, it has been identified as one of the differentially expressed miRNAs in various cancer types such as PDGFRA, RAC1, IKBKG, XIAP, and PPM1D [PMC9983174]. Overall, hsa-mir-1203 is a dysregulated microRNA that has potential implications in cancer therapy and genetic interactions.

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCGGAGCCAGGAUGCAGCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-1203
Publications