v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 290 (LINC00290) URS000075A4B6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00290: LINC00290 is a long intergenic non-protein coding RNA (lncRNA) that has been reported to undergo recurrent deletions in various studies [PMC7794582] [PMC7567804] [PMC9654521] [PMC6162788]. It has been identified as a common fragile site and a frequently deleted region in different cancer types [PMC7567804] [PMC4332354]. LINC00290 deletions have been found in both adult and pediatric cohorts, suggesting its involvement in cancer development across different age groups [PMC9654521]. It has also been implicated as a potential driver gene in cervical cancer and adrenocortical tumors [PMC9091225] [PMC7957049]. LINC00290 is part of a focal deletion region that is frequently observed in TP53-mutated adrenocortical tumors, further supporting its role as an oncogene candidate gene [PMC9091225]. Additionally, LINC00290 has been identified as an inflammatory biomarker and may have competitive binding activity with hsa-mir-30a-5p [PMC9987318]. Overall, LINC00290 is an lncRNA that undergoes recurrent deletions and plays a role in various cancers, making it an important target for further research into its functional significance and potential therapeutic implications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCAUGAUGGCUCCGUCUCAUUCUGUCACAGAUCGUCUUUAUAAGCCAGACAUUUCAGUGCUAUAAACUGAUGAGACACCCACAGAAUUUAACAGAAAUCGAAGGUGUGGAAAGGAUCUCAGACAAGCGAAUCCAUCACUGUUACUGUACAGAUAAGAAAUGGAGGCCAAAUAGGAUUAGCAACUUGCUCAGGACUCCACAGAAAGAGCAGCAACUGGAUGGCACAGAAUGAGUUCUGACGUUUACAUCAGAAGAUGGCCCUGAACCGGAGCCAAAGCUGGCCGAGGAGCUGGGGGAGAUUCUGAGACUCACACUUUCAUUUGUGAAGUGAGAUGCUGACUCUAUUGUUGGUUUUGUUUGGGGGUUUGAUGCUGAAAUAAAGCAAUACACACGAGGAAAUUUACUGGCAUUGUAUUAAAAAACAAAGUUAAUGUAUGAUGAUGCCGUAGAGUGAUUCAUGAAUGGCAUUAUGAAUAUUUUAAAAACACAAAAGGAAUUAAAAGAGUAUACUUGGAUGUUAAUGAAAAUAAAAUUUCAUUGAGAACAAGAAUCUUGGUAAACAUCAGUUGAUAUUAAAAAUUUAUUGCUUUUAAAAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications