Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-49601231 URS000075A494_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUUGUUUGUACAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Cyprinus carpio (common carp) ccr-let-7j
  2. Danio rerio dre-let-7j
  3. Gadus morhua gmo-let-7j-5p
  4. Hippoglossus hippoglossus hhi-let-7j
  5. Ictalurus punctatus (channel catfish) ipu-let-7j
  6. Lepisosteus oculatus (spotted gar) Loc-Let-7-P2c3_5p (mature (guide))
  7. Monopterus albus (swamp eel) Mal-Let-7-P2c3_5p (mature (guide))
  8. Tor tambroides let-7j
  9. Xenopus laevis (African clawed frog) xla-let-7j-3p
  10. Xenopus tropicalis Xtr-Let-7-P2c3_5p (mature (guide))