Erinaceus europaeus (western European hedgehog) miRNA (ENSEEUG00000015999.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Erinaceus europaeus (western European hedgehog) miRNA (ENSEEUG00000015999.1) URS000075A408_9365

109 nucleotides
1 database (Ensembl)
Found in 17 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

ACUUGUGAGGAAAUAAAGGAAGUUAGGCUGAGGGGCAGAGAGCGAGACUUUUCUAUUUUCCAAAAGCUCGGUCUGAGGCCCCUCAGUCUUGCUUCCUACCCCGCGCUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

Cavia porcellus miRNA (ENSCPOG00000016609.3)
Chinchilla lanigera (Long-tailed chinchilla) miRNA (ENSCLAG00000018141.1)
Cricetulus griseus (Chinese hamster) microRNA mir-423 (ENSCGRG00000021268.1, ENSCGRG00001001823.1)
Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000004207.1)
Heterocephalus glaber (naked mole-rat) miRNA (ENSHGLG00000022118.1, ENSHGLG00100022774.1)
Ictidomys tridecemlineatus miRNA (ENSSTOG00000025242.1)
Loxodonta africana (African savanna elephant) miRNA (ENSLAFG00000028500.1)
Mesocricetus auratus (Golden Hamster) miRNA (ENSMAUG00000005882.1)
Mus caroli microRNA 423 (MGP_CAROLIEiJ_G0007139.1)
Mus musculus microRNA mmu-mir-423 precursor
Mus pahari microRNA 423 (MGP_PahariEiJ_G0006857.1)
Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000021933.1)
Myotis lucifugus miRNA (ENSMLUG00000017821.1)
Octodon degus miRNA (ENSODEG00000021723.1)
Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017286.1)
Pteropus vampyrus (large flying fox) miRNA (ENSPVAG00000025196.1)
Vicugna pacos (alpaca) miRNA (ENSVPAG00000016435.1)

2D structure