Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-335 URS000075A30F_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-335: Ssc-mir-335 is a microRNA that has been identified as one of the most affected miRNAs in various studies [PMC9532862]. It has been found to be strongly correlated with numerous mRNAs and circRNAs in the ceRNA network [PMC9532862]. The rs334590580 (T/C) SNP located at the precursor stem region of ssc-mir-335 has been associated with palmitic and arachidic acids content in GM tissue [PMC8097994]. Expression analysis using the miRCURY LNA™ microRNA PCR system revealed that ssc-mir-335 is highly enriched in the RISC compartment [PMC6395673]. It has also been observed that ssc-mir-335 shows an opposite expression pattern between uterus and serum, with up-regulation in uterus and down-regulation in serum [PMC6598998]. In studies on fibre type regulation, ssc-mir-335 has been identified as one of the miRNAs that may be involved [PMC4410957].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAAGAGCAAUAACGAAAAAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

Publications