Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens small nucleolar RNA, C/D box 113-1 (SNORD113-1) secondary structure diagram

Homo sapiens small nucleolar RNA, C/D box 113-1 (SNORD113-1) URS000075A0F8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD113-1: SNORD113-1 is a small nucleolar RNA (snoRNA) that has been studied in relation to its effects on MEK and ERK1/2 phosphorylation. Overexpression of SNORD113-1 was found to significantly decrease phosphorylation of MEK and ERK1/2, while not significantly altering the expression of total ERK and total MEK [PMC4169825]. SNORD113-1 has been identified as a tumor suppressor in hepatocellular carcinoma (HCC) patients with overexpression of ACSL4 [PMC7599548]. In HepG2 cells, treatment with 5 μmol/L 5-Ad for 48 hours resulted in a 2.06-fold increase in SNORD113-1 expression levels compared to vehicle-treated cells [PMC4169825]. The SNORD113-1 gene is located on chromosome 14q32 within an intron of the small nucleolar RNA host gene 23 (SNHG23, Gene ID: 100507242), along with several miRNAs and other C/D snoRNAs [PMC4169825]. Overall, these findings suggest that SNORD113-1 plays a role in regulating the phosphorylation of MEK and ERK1/2, as well as functioning as a tumor suppressor in HCC patients with overexpression of ACSL4.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAGUGAGUGAUGAAUAGUUCUGUGGCAUAUGAAUCAUUAAUUUUGAUUAAACCCUAAACUCUGAAGUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications