Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4301 precursor URS000075A09B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir4301: MIR4301 is a non-coding RNA, specifically a microRNA, that is 65 base pairs in length and is located on chromosome 11 within the intronic region of the DRD2 gene [PMC3772989]. This microRNA has been identified as having a significant association with systolic blood pressure (SBP) regulation in sickle cell disease (SCD) cohorts, as indicated by gene-based tests and the presence of shared associated SNPs with the DRD2 gene [PMC3772989]. The expression of MIR4301 is tissue-selective, and it has been found to have a significant p-value ranking in studies examining physically close genes [PMC6836538]. Notably, MIR4301 has a predicted binding site on the 3’ UTR region of the DRD2 transcript, suggesting that it may play a role in regulating DRD2 expression [PMC3772989]. The significance of MIR4301 was underscored by its p-value of 5.2x10^-5 in genetic association studies [PMC3772989]. Additionally, MIR4301 is one of several microRNAs located within the 11q23.3 SRO region; however, its function and that of other miRNAs on chromosome 11q remains to be fully elucidated [PMC5492892].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCAGCCACCUCCCACUACUUCACUUGUGAACAUUGCAUUCGUGGAGGGUGGCAGGUGCAGCUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Expression Publications