Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-1470 precursor URS0000759FF8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1470: MIR1470 is a tumor-associated miRNA that has been shown to be upregulated in stages 3 and 4 of cancer [PMC4094766]. In a study, the target mRNAs of MIR1470 were analyzed, and a total of 71 target mRNAs were identified [PMC4094766]. miRNAs are endogenous small ncRNAs that are approximately 22 nt in length [PMC4094766]. MIR1470 has been specifically identified as one of the known leukemia-associated miRNAs [PMC4094766]. The analysis also revealed that there were 526 target mRNAs for MIR1470 [PMC4094766]. The study further investigated the mRNAs that were both targets of MIR1470 and downregulated in stages 3 and 4, providing valuable insights into the potential role of MIR1470 in cancer progression [PMC4094766]. Reference: [PMC4094766] Zhang, J., Zhang, Z., Wang, Q., Xiong, J., & Wang, J. (2014). Identification of differentially expressed microRNA-associated mRNAs in different stages of colorectal cancer. Oncology Letters, 8(2), 677-682.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCUCCGCCCGUGCACCCCGGGGCAGGAGACCCCGCGGGACGCGCCGAGGUAGGGGGGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Publications