Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-302b precursor URS0000759FEB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR302B: MIR302B is a member of the miR302 cluster, which is known to play a role in promoting human somatic cell reprogramming [PMC4164941]. In a mouse endothelial cell model, the expression of MIR302B and miR302c was down-regulated by ROCK1 siRNA and ROCK2 siRNA [PMC4164941]. Knockdown of p120 or p120-Kaiso siRNAs in human corneal endothelial cells (HCECs) resulted in increased expression of MIR302B and miR302c [PMC4164941]. Noggin blocked the overexpression of MIR302B and miR302c, as well as the nuclear translocation of ESC markers and positive expression of neural crest markers [PMC4164941]. In HCEC monolayers, reprogramming by canonical BMP signaling was associated with nuclear staining of Oct4, Sox2, and Nanog, as well as up-regulation of MIR302B [PMC4164941]. MIR302B is also upregulated in ESRD-hiPSC-ECs (endothelial cells derived from induced pluripotent stem cells) associated with oxidative stress and inflammation [PMC8685359]. It is highly expressed in human oral fibroblast-induced pluripotent stem cells (hOF-iPSCs) along with other pluripotent markers such as NANOG and OCT4 [PMC4538314]. MIR302B has been shown to induce apoptosis in tumor/cancer cell lines when overexpressed along with other members of the miR-302 cluster such as MIR302A, MIR302C, and MIR302D [PMC4400607]. It has also been implicated in regulating EGFR expression at the translational level in SMMC-7721 cells [PMC3850949]. Overall, MIR302B is a member of the miR302 cluster that plays a role in somatic cell reprogramming, pluripotency, and apoptosis in cancer cells [PMC4164941][PMC8685359][PMC4538314][PMC4400607][PMC3850949].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUCCCUUCAACUUUAACAUGGAAGUGCUUUCUGUGACUUUAAAAGUAAGUGCUUCCAUGUUUUAGUAGGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications