Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-600 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-600 precursor URS0000759FE6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-600: Hsa-mir-600 is a microRNA (miRNA) that has been identified in various studies [PMC3726785] [PMC9293659] [PMC3794036] [PMC5635130] [PMC7196262] [PMC2630984] [PMC4951313] [PMC5403669]. It has been associated with lung cancer and other types of cancer, such as breast, colorectal, and ovarian cancer [PMC7196262] [PMC9952540]. Hsa-mir-600 has been found to be upregulated in certain conditions, including high-grade Gleason score and presence of extraprostatic extension in prostate cancer patients, as well as lymphatic invasion in lung cancer patients [PMC7196262]. In silico analysis has predicted that hsa-mir-600 can bind to specific target regions and potentially alter miRNA regulation [PMC5635130]. Hsa-mir-600 has also been identified as a miRNA that can bind to the 3'UTR of certain genes, such as G72, and potentially affect their expression levels [PMC2630984]. Inhibition of hsa-mir-600 has been shown to modulate the expression levels of various target proteins in cell studies, including KI-67 and MEGF10 in SH-SY5Y cells [PMC4951313]. Overall, hsa-mir-600 is a miRNA that has been implicated in various types of cancer and may play a role in regulating gene expression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGUCACGUGCUGUGGCUCCAGCUUCAUAGGAAGGCUCUUGUCUGUCAGGCAGUGGAGUUACUUACAGACAAGAGCCUUGCUCAGGCCAGCCCUGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

2D structure Publications