v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) FAS antisense RNA 1 (FAS-AS1) URS0000759F33_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FAS-AS1: FAS antisense 1 (FAS-AS1) is an antisense long non-coding RNA (lncRNA) that has been observed to be significantly increased in infected MDMs compared to bystander or uninfected MDMs [PMC7151623]. The overexpression of EZH2 has been found to induce H3K27me3 at the promoter of FAS-AS1, resulting in the downregulation of FAS-AS1 [PMC7645065]. Additionally, a study selected a set of five differentially expressed lncRNAs, including FAS-AS1, to investigate their expression in relation to the clinical parameters of patients [PMC8227049]. FAS-AS1 is an antisense lncRNA that has been found to be upregulated in infected MDMs compared to uninfected MDMs [PMC7151623]. The overexpression of EZH2 can lead to the downregulation of FAS-AS1 through H3K27me3 induction at its promoter [PMC7645065]. Furthermore, a study examined the expression levels of five differentially expressed lncRNAs, including FAS-AS1, and their association with clinical parameters in patients [PMC8227049].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCCAAGUAAUUAGCACUUUGCAUCUAUUUUAUUUAUUGCUACUACUAAGAAAACAUAACCGUGAAGGCAUAAAAGCAAACAUUUUCUGUAGACACAUGAGGUGACACAAGAGUGUUGAAACUUCUUUAAGGAUAAAGGCCUGAUGUUAGGCAUGUCGUGAGCGCAAAACCAAUUUCUGUGUAACUAAAUUUAAAAGAGUCAUAUUAGAGGGGAGAAAUGGAAGAUAAACUGCAAAACGUAAACAAUGAUUACUUAGGUGAUAGAGUUAUGUCUGAUCUUUGUAUUUGACUCAUCUGCAUUUAUAAAUUUUAUUUAAUAAGCCUUAAUUUCCUAGGCCAUAUAUCAUAUACAAAUAUAAGUUAUACCUAACUUAUAGGUAUUAUAAUAUGUAUAUAUACAUAAAUGUAUGAAUAUUUACAUAUGCGUGUGUGUGUGUAUUCUUUCAGAAAAGCAAAGUUUUCUUCGGGCUUUAAACACGCAGCCUCUGGUAAAGGUGCUAUUGGUACAAAAGUUCAACAAGCAUAGCUCCAAGCUUUGACAAUUUUCUUACACUUUACUAAUACUGCUGUCCAAAAACUAUGAGAUUUUCAAAGCAGCCAACAUUGCAGUGGUGCAAUGGUUAAUAACAAGAGAGAGAAGAGUGUGGCCUGAGGUUGUAUAAAUGUUUUCUCAAUCUUGAAUCAUUAAUUUUCUCCAAGGAAGUUUCUAAAGAAUCCCAAAUAGUGCACACUAUUUCUGAAAGGAACAGGAUUUUUUUUUCUAAUCAUAAAAUGGACCCAGACAUCUCAGCCUCUUGGUGUAAUCUGGAUAUCAGAUGCAAUCAGCGAACAGCCUGAGUUUUGGAAUUAGAUCUGAGUUCAAUCCCAUAUCUCCCAUUUACUAGCUGUGUGAUCUUGGCUGAAUUACUGAAGCUCUCUGAACCUCAUUUCGCCAUCUGUAAAAUGGGGAUGUGGUUAUCUUCCCCACUACAUGGCUCUCGUGAGAAUCCGCGGAGAUCACAUUUGUAAACACUUCUCUCGCUAUGCCUGGCACUUUGUUGGGGCCCAAUAAAAUAAAAAUCCAUGGACUCUCAGAGGCUCCGGUACUCAAAUGAGCCUCCUGGAUCCACGUCUCUUUGAUUAGCCAUCUGCAAGCUGGCAUUUCUGAGCGAGGGACUUUUCAAAACAGGCUGCUCAAGUUUCUUGGCCAAUAAUAGGCGCCGGGUUCUGUGCGGUGGGAACGAGUACCACCAACCCCAGCAGGAGACCAAGCAGAAAUCACCAUGGGAGUGCAAGCUAAGAAAGGGCAAAAGAAGAAAGAGAAGGGCAGAAAAACAAAACAAAAUGAAACCACUCAGGCAGCGACUUACAGUCUUAAAGAGAGAAUUCCCGGAAGGGAGACAAGGCAGUUUCUUUUUCUGUGUGACAAUAAAAAACGGUAAACAAGCCUCCAGAAGCUCAUUCAGCCCCCAUAUAACUUUUUCGAGAAAGAAAAGGUGCCGUUCUUCCGAGCCCUCCGGCUUAACCACUGCUUCGGUGCUGACUUAUUUCCUACGUCUGAGAACUGCCAGAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications