v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1413 (LINC01413) URS0000759DCE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01413: LINC01413 is a long non-coding RNA (lncRNA) that has been implicated in colorectal cancer (CRC) [PMC6953771]. Knockdown of LINC01413 in HT-29 cells with overexpression of LINC01413 resulted in a reversal of increased ZEB1 expression and decreased phosphorylation levels of YAP1 and TAZ1 [PMC6953771]. These findings suggest that LINC01413 may serve as a potential prognostic and therapeutic target in CRC [PMC6953771]. However, further research is needed before its eventual application can be realized [PMC6953771].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CGGUACUGAGAGCAGCCAUCUUGGAGCUUGGAAACGGAGACGCAUGUGAAGCCGUUUGCACAGUAUUUUUCCCUUAAAAUAUGGGUGGGGAACAAGGGGCUGUCAUUUGUCUUUUUCUUUGGGAUGGUGAGCAGUGAGCAGGGCACGCCGCGAGGAGCAAACUGCAGCCCAAGCACACGCGGUCAGCACGCGGAGCACAGGUGGGGAGAAGCGGCUGACGGUGGCGUGGCCCCGCGUACCUGGGUGUGGACGCCCCGCCGCCCCGCAGGGGAAAGCUCCUGGAGUCUGGGGUCUGCUGCCCCGAGCUCUGGGUGUCCAGCCUCUGCCUCAACUGAAAUCUGAAGAUCAGGCCAAUUUCGUGGUCUCUCAGACGUCGGUAAACAAGAGGCCUUGGCUCCUCAGGAGACCGAGAGUCUCUCACUGUACUUCCUUCUCUUGGCUCCAAGGACAUAGAACGGUUGCUAUGGGGAUUCCUUCAUUUGUAAAGACAAUCAUGCUGGCUGUUAGUGAAGAAUGGCCUGGAGCACUGGGUCUCCGCCCCAGCUGCCUGGGAGAAACUGUGUUGAAGGAGCCAUACCCCCUGGCCUCCCCUCCAGACUCCAGACAACCCCAGUCAGCUGGCUGGGAGGGAGGCAGAAGAGAAACAGGGGUGCACCUGGGGCUCCUGCAGGGGUCCAGCCAGGAGAUGGGGGCAACUUGGACAGGGACGAUCCUGGGAAGGGCAGGAGGAGGAGUGAGACCUGGCCUGCCCUCUCCCUAGAGGCUCAUCAGCUCCCUGGAGACAGACACGCCCUGGUUCCUUUCCCUAUGCCUGGAGCCUGGGUACCAGCUAUUGAAAACUGCUUUUCUCCUUGUUCAUUCAAACAUAUUCACACAUAAAGGUUGUCAUUCCUUUUUGUCACUAUUUGACAAAAAUUGGAUCAUACCGUAUACAAUUCUCUGCUAUUUGUUUUGCUCACCUAACAAUAAAUACACUGUGAAAAAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications