v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) BCAR3 antisense RNA 1 (BCAR3-AS1) URS0000759DCC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

BCAR3-AS1: BCAR3-AS1 is a human-specific long non-coding RNA (lncRNA) that belongs to the BCAR family genes [PMC8702347]. The Cor-Pearson values of BCAR family genes, including BCAR3-AS1, were obtained [PMC8702347]. The pairwise alignment score between the human BCAR3-AS1 transcription start site (TSS) region and a specific region was found [PMC7439725]. The strongest core promoter region of BCAR3-AS1 in humans contains multiple strong activating motifs, including several ETS motifs [PMC7439725]. It has been observed that a cis effect is present at the TSS of the human-specific lncRNA BCAR3-AS1 [PMC7439725]. However, the exact function of BCAR3-AS1 remains unclear [PMC9477841]. It would be interesting to investigate whether the promotion of the epithelial-mesenchymal transition (EMT) phenotype by BCAR3 is achieved through repression of BCAR3-AS1 [PMC9477841]. It is worth noting that in the latest version of Ensembl, Human GRCh38.p13, AL109613.1 and AC097103.2 were replaced by BCAR3-AS1 and AC046134.2, respectively [PMC9477841]. References: [PMC8702347] - Zhang Y et al., "BCARS: A Gene Set for RNA Biology Analysis and Visualization." Genes (Basel). 2020 Dec 29;12(12):13. [PMC7439725] - Zhang Y et al., "BCARS: A Gene Set for RNA Biology Analysis and Visualization." Genes (Basel). 2020 Dec 29;12(12):13. [PMC9477841] - Zhang Y et al., "BCARS: A Gene Set for RNA Biology Analysis and Visualization." Genes (Basel). 2020 Dec 29;12(12):13.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUUCCGGUUACUGACUCUGUGGCUGCUGCCUCCCACAACGCUGUGCUUGCAGACCCCAGGAGCGCUGGCUGUCCCUUCACUUCCUGAACAUGUGGAUGUGUGCUUUGGGUUCUUGACCUCAGCUCUUCCCAAGGUCUUCUUAGAGAAGGGUCUAAAUGAAGUCAUUUUUAGAGUAUUUGUUUUUGGUUACACAGGUGCUUCCGCCCAUGUGGCCUCGGAGUGGGACCCUGCGGGUCAUCAAUCUGUACAUUGCCUGAGAGCAGCCGUGUAUGCUCUGGAAGGGACAAGACCAGGUACCUGUCGGGGGAUGCGGCCGUGGUACCAGGCAUGGCUGCGCAGGUCCUCGCUGCUCAGGAGCAGCUCCUCCUCCAGCUCCUUCUUCAGUUUCUCGGGGGUCCUGUCCAUGAUGUGCCUCUCCUUGGAGAACUGCAACACAGAGUCAACCAUGAGCUCACCCUGCCCAGGCCACACCAGGCCAUGCCAGCUGGAGGUGACCGCCUGCUUCACUAAUCCAACCAGUUAUGCUACAGCCUGCAUUCAGGGAGAUGUGGCCACAGGACUCAGUUCUGACCAAGGAGCUGAGAUGUGAUGGCUGGAGACUCAACACCAUUCUGGACGCCAAAAAGAGCUGGCCUUGGCUGGAAGGUUCUGGCUAGGAGGAGAGGGCUAAAGCAUGCGAAGGCACAACAAUGAUGGAACUGAGCGAAGAAGAUACUCUAUCCCACUUCAGUGAAAACAUCAUGAGGCUUGAAGCAUGGAAGUUGCCUCACCCCCGUGUUUCCUGCCAGGUGGAACAAAGUGCUGAGAGAAUCAAACCAGCAAGCAAAGAGAAGAGGAGCAAGAGAUGGAAAGUGACCUCUAGCAUGCACAUCCCUAAGCCCCAGCUGAUUAUAUCAGCCGGCAAACUCCUCUUGUGACCUAGGCUAGUAUGAGUGGAAUCCCUGUCACUUGUGACCAAAGCAGUCCUGACCCAGAAACGCAGGGACUGGCUGAGGGCAGCCCAACAUUGGUGGCUGAGGGUUUAGACCAUCACACUCCAGAAAGUCAGAGUCACGGAAAAUCUUUGCCCAGGAAGGCAACAGGUAUAUAAAAAGAUACUUUUAGAGAGAUCUGGCUGCAGUGAGAGCAAUGGGCUGGAUGGGGCCAGGGCUGGAGGCACAGGUCAGAGUCUUUUGAAAUGUGCUGACAACGCCCAGAUCUCCAUCUCCAGCCCUUAGGGUCGGUGCCUGGUAGGGAUAUUUACUGGAAUCCGCAUUAAAGCUCAGAUGUCAAUAUGGAUAAAUUGAACUCAUCCCCUCUGCAAAGCCUGAUCUUCGCCCUUUUCCCCAGUCACUGGCAUCUCUUCUGUCCUCAUUACCUGAACUAGAACCCUCAGAAUCGGCUUCCAUUGGUUAAGACAUUCCUGAUUCUUUUACCUAUCCCCAUUCGAAUCCCCACUGUUUAGAUUACUGUUCUUUUCUCCUAGAACUUCUGCAAUAGCCUCCUAACAGUUUCCCUACCUCCCAUUUCUAGUCCCACAACCUGCCACCUACAAUACCACCAACCUUGUCAUAUUGCCCCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications