Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1260b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1260b precursor URS0000759BF7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir1260b: MIR1260B is a microRNA implicated in various cellular processes and has been identified as a potential biomarker in cancer research [PMC8504092]. Analysis has revealed that miR-1260b is closely associated with the Serine/Threonine-protein kinase family, including CHEK2 and CDK4, which are important in cell cycle regulation [PMC8504092]. It has been suggested that miR-1260b, along with miR1260a, shows differential expression in the peripheral blood of ovarian cancer patients compared to healthy controls, indicating potential prognostic and diagnostic significance [PMC8504092]. Furthermore, common gene targets of MIR1260B have been identified to interact at the protein level [PMC8504092]. In prostate cancer (PCa), MIR1260B expression can be modulated by genistein, which affects cell proliferation by altering both oncogenic and oncosuppressor microRNAs [PMC7072821]. Additionally, MIR1260B interacts with various protein-coding genes and non-coding RNAs including HNRNPK, suggesting a complex regulatory network influenced by this microRNA [PMC9730017]. Inhibition of MIR1260B has been shown to affect cell proliferation in colorectal cancer cells when combined with chemotherapeutic agents like 5-FU [PMC6144919], while genistein-mediated down-regulation of MIR1260B can decrease PCa cell proliferation through epigenetic modifications [PMC5068501].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCCGUUUAUCCCACCACUGCCACCAUUAUUGCUACUGUUCAGCAGGUGCUGCUGGUGGUGAUGGUGAUAGUCUGGUGGGGGCGGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression GoFlow Results Publications