Falco tinnunculus (common kestrel) miRNA (ENSFTIG00000010915.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Falco tinnunculus (common kestrel) miRNA (ENSFTIG00000010915.1) URS0000759A48_100819

98 nucleotides
1 database (Ensembl)
Found in 12 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGUAGUUGCCCAUCAAUCGCUCAGUAGUCAGUGUAGAUUCUGUCUUUACAAUCAGCAGCUACAUCUGGCUACUGGGUCUCUGAUGACAUCUCAUAUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

Accipiter nisus (Eurasian sparrowhawk) microRNA 222 (ENSANIG00000006195.1)
Aquila chrysaetos chrysaetos microRNA 222 (ENSACCG00020000824.1)
Athene cunicularia (burrowing owl) microRNA 222 (ENSACUG00000013021.1)
Bubo bubo (Eurasian eagle-owl) miRNA (ENSBOBG00000013087.1)
Buteo japonicus (eastern buzzard) miRNA (ENSBJAG00000016131.1)
Calidris pygmaea miRNA (ENSCPGG00000010134.1)
Gallus gallus microRNA gga-mir-222a precursor
Numida meleagris microRNA 222 (ENSNMEG00000013116.1)
Pavo cristatus (Indian peafowl) microRNA 222 (ENSPSTG00000016865.1)
Strigops habroptila microRNA 222 (ENSSHBG00005010252.1)
Strix occidentalis caurina miRNA (ENSSOCG00000010691.1)

2D structure