Coturnix japonica (Japanese quail) microRNA 301a (ENSCJPG00005017247.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Coturnix japonica (Japanese quail) microRNA 301a (ENSCJPG00005017247.1) URS0000759A26_93934

90 nucleotides
1 database (Ensembl)
Found in 6 other species
44 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GUUGCUGCUAACGAAUGCUCUGACUUUAUUGCACUACUGUACUUCACAGCUAGCAGUGCAAUAGUAUUGUCAAAGCAUCUGAAAGCAGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Amazona collaria microRNA 301a (ENSACOG00000005086.1)
Chrysolophus pictus miRNA (ENSCPIG00010003341.1)
Gallus gallus microRNA gga-mir-301b precursor
Meleagris gallopavo (turkey) microRNA 301a (ENSMGAG00000000373.2)
Pavo cristatus (Indian peafowl) microRNA 301a (ENSPSTG00000016973.1)
Phasianus colchicus microRNA 301a (ENSPCLG00000006509.1)

Publications