Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Ochotona princeps tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2) secondary structure diagram

Ochotona princeps tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2) URS0000757938_9978

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUCCAGUGGCGCAAUCGGUUAGCGCGCGGUACUUAUAAUGCCGAGGUUGUGAGUUCGAUCCUCACCUGGAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Ailuropoda melanoleuca tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  2. Alligator mississippiensis tRNA-Ile (TAT) (tRNA-Ile-TAT-2-1)
  3. Balaenoptera acutorostrata scammoni tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  4. Bos taurus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  5. Callithrix jacchus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  6. Callorhinchus milii tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  7. Canis lupus familiaris tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  8. Carlito syrichta tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  9. Cavia porcellus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  10. Ceratotherium simum simum tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  11. Chlorocebus sabaeus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  12. Cricetulus griseus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  13. Dasypus novemcinctus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  14. Dipodomys ordii tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  15. Echinops telfairi tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  16. Eptesicus nilssonii tRNA-Ile
  17. Equus caballus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  18. Erinaceus europaeus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  19. Felis catus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  20. Gorilla gorilla gorilla tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  21. Heterocephalus glaber tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  22. Homo sapiens tRNA-Ile (anticodon TAT) 1-1 (TRI-TAT1-1)
  23. Ictidomys tridecemlineatus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  24. Macaca mulatta tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  25. Microcebus murinus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  26. Monodelphis domestica tRNA-Ile (TAT) (tRNA-Ile-TAT-1 1 to 3)
  27. Mus caroli tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  28. Mus musculus castaneus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  29. Mus musculus domesticus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  30. Mus musculus musculus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  31. Mus musculus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  32. Mus pahari tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  33. Mus spretus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  34. Mustela putorius furo tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  35. Myotis lucifugus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  36. Nomascus leucogenys tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  37. Notamacropus eugenii tRNA-Ile (TAT) (tRNA-Ile-TAT-1 1 to 3)
  38. Oryctolagus cuniculus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  39. Otolemur garnettii tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  40. Ovis aries tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  41. Pan troglodytes tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  42. Papio anubis tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  43. Petromyzon marinus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  44. Pongo abelii tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  45. Procavia capensis tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  46. Rattus norvegicus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  47. Sarcophilus harrisii tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  48. Sorex araneus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  49. Sus scrofa tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  50. Trichechus manatus latirostris tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  51. Tursiops truncatus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  52. Vicugna pacos tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
2D structure