Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Microcebus murinus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3) secondary structure diagram

Microcebus murinus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3) URS000074FC25_30608

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUCGAUAGCUCAGUUGGUAGAGCGGAGGACUGUAGAUCCUUAGGUCGCUGGUUCGAAUCCGGCUCGAAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 66 other species

  1. Acropora cervicornis tRNA-Tyr
  2. Acropora millepora tRNA-Tyr
  3. Ailuropoda melanoleuca tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  4. Albula goreensis tRNA-Tyr
  5. Alosa alosa tRNA-Tyr
  6. Anguilla anguilla (European eel) tRNA-Tyr
  7. Balaenoptera acutorostrata scammoni tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  8. Bos taurus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 4)
  9. Branchiostoma floridae tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 7)
  10. Callithrix jacchus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  11. Canis lupus familiaris tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  12. Carlito syrichta tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  13. Cavia porcellus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  14. Ceratotherium simum simum tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  15. Chlorocebus sabaeus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  16. Choloepus hoffmanni tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  17. Cricetulus griseus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 5)
  18. Danio rerio tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 7)
  19. Dasypus novemcinctus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  20. Dipodomys ordii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  21. Echinops telfairi tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  22. Eptesicus nilssonii tRNA-Tyr
  23. Equus caballus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1)
  24. Erinaceus europaeus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  25. Felis catus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  26. Gorilla gorilla gorilla tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  27. Heterocephalus glaber tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  28. Homo sapiens (human) tRNA-Tyr (anticodon GTA) 1-1 (TRY-GTA1-1)
  29. Ictidomys tridecemlineatus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  30. Loxodonta africana tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  31. Macaca mulatta tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  32. Mus caroli tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 5)
  33. Mus musculus castaneus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 5)
  34. Mus musculus domesticus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 5)
  35. Mus musculus musculus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 5)
  36. Mus musculus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 5)
  37. Mus pahari tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 5)
  38. Mus spretus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 4)
  39. Mustela putorius furo tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  40. Myotis lucifugus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1)
  41. Nomascus leucogenys tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  42. Nothobranchius furzeri tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  43. Ochotona princeps tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  44. Orbicella faveolata (Mountainous star coral) tRNA-Tyr
  45. Oreochromis niloticus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 6)
  46. Oryctolagus cuniculus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  47. Oryzias latipes tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 4)
  48. Otolemur garnettii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  49. Ovis aries tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  50. Pan troglodytes tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1)
  51. Papio anubis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  52. Pocillopora damicornis tRNA-Tyr
  53. Pongo abelii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  54. Procavia capensis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  55. Rattus norvegicus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-4-1)
  56. Saccoglossus kowalevskii (Acorn worm) tRNA-Tyr
  57. Saimiri boliviensis boliviensis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  58. Sarcophilus harrisii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  59. Scleropages formosus tRNA-Tyr
  60. Sorex araneus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  61. Stylophora pistillata (Hood coral) tRNA-Tyr
  62. Sus scrofa tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  63. Takifugu rubripes tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1)
  64. Trichechus manatus latirostris tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  65. Trichoplax sp. H2 tRNA-Tyr
  66. Tursiops truncatus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  67. Vicugna pacos tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
2D structure Publications