v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Macaca mulatta (Macaque) Small nucleolar RNA SNORD18 (ENSMMUG00000026093.3) secondary structure diagram

Macaca mulatta (Macaque) Small nucleolar RNA SNORD18 (ENSMMUG00000026093.3) URS000072BDC5_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCAAAAUGAUGAGAUUCCACUUAAUUGGUCCGUGUUUCUGAAACACAUGAUAUUUGUGGAAAUUCUGACUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Cercocebus atys (Sooty mangabey) Small nucleolar RNA SNORD18 (ENSCATG00000007666.1)
  2. Chlorocebus sabaeus Small nucleolar RNA SNORD18
  3. Colobus angolensis palliatus (Angola colobus) Small nucleolar RNA SNORD18 (ENSCANG00000016366.1)
  4. Felis catus Small nucleolar RNA SNORD18 (ENSFCAG00000034974.2)
  5. Homo sapiens small nucleolar RNA, C/D box 18B (ENSG00000202529.1)
  6. Lynx canadensis Small nucleolar RNA SNORD18 (ENSLCNG00005000818.1)
  7. Macaca fascicularis (Crab-eating macaque) Small nucleolar RNA SNORD18 (ENSMFAG00000011980.2)
  8. Macaca nemestrina Small nucleolar RNA SNORD18 (ENSMNEG00000017160.1)
  9. Mandrillus leucophaeus (Drill) Small nucleolar RNA SNORD18 (ENSMLEG00000008729.1)
  10. Nomascus leucogenys Small nucleolar RNA SNORD18 (ENSNLEG00000020972.2)
  11. Pan paniscus Small nucleolar RNA SNORD18 (ENSPPAG00000014069.1)
  12. Pan troglodytes Small nucleolar RNA SNORD18 (ENSPTRG00000026557.2)
  13. Papio anubis (olive baboon) Small nucleolar RNA SNORD18 (ENSPANG00000006460.3)
  14. Piliocolobus tephrosceles (Ugandan red Colobus) Small nucleolar RNA SNORD18 (ENSPTEG00000033547.1)
  15. Theropithecus gelada (gelada) Small nucleolar RNA SNORD18 (ENSTGEG00000024856.1)
 2D structure Publications