Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Camelus ferus (Wild Bactrian camel) microRNA mir-154 secondary structure diagram

Camelus ferus (Wild Bactrian camel) microRNA mir-154 URS000072B1BC_419612

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUACUUGGAGAGAGGCUGGCCGUGAUGAAUUCGAUUCAUCAAAGCGAGUCAUACACGGCUCUCCUCUCUUUUAGUGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Chlorocebus sabaeus microRNA mir-154
  2. Fukomys damarensis microRNA mir-154
  3. Gorilla gorilla gorilla microRNA mir-154
  4. Homo sapiens microRNA mir-154
  5. Macaca mulatta microRNA mir-154
  6. Microcebus murinus mir-154 microRNA precursor family
  7. Mustela putorius furo (domestic ferret) microRNA mir-154
  8. Nomascus leucogenys microRNA mir-154
  9. Otolemur garnettii microRNA mir-154
  10. Pan troglodytes (chimpanzee) microRNA mir-154
  11. Papio anubis (Olive baboon) microRNA mir-154
  12. Pongo abelii (Sumatran orangutan) microRNA mir-154
2D structure Publications