v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Ursus maritimus (Polar bear) miRNA (ENSUMAG00000007394.1) secondary structure diagram

Ursus maritimus (Polar bear) miRNA (ENSUMAG00000007394.1) URS0000729723_29073

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Ailuropoda melanoleuca microRNA 185 (ENSAMEG00000022784.2)
  2. Pan troglodytes microRNA ptr-mir-185 precursor
  3. Rhinolophus ferrumequinum microRNA 185 (ENSRFEG00010021484.1)
  4. Suricata suricatta (meerkat) microRNA 185 (ENSSSUG00005022560.1)
  5. Ursus americanus miRNA (ENSUAMG00000010862.1)
  6. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 185 (ENSUTTG00000003759.1)
  7. Zalophus californianus miRNA (ENSZCAG00015017390.1)
 2D structure