Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pongo abelii (Sumatran orangutan) microRNA mir-154 secondary structure diagram

Pongo abelii (Sumatran orangutan) microRNA mir-154 URS000072370A_9601

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUGCUUAAAGAAUGGCUGUCCGUAGUAUGGUCUCUAUAUUUAUGAUGAUUAAUAUCGGACAACCAUUGUUUUAGUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Chlorocebus sabaeus microRNA mir-154
  2. Echinops telfairi mir-154 microRNA precursor family
  3. Gorilla gorilla gorilla microRNA mir-154
  4. Homo sapiens microRNA mir-154
  5. Macaca mulatta microRNA mir-154
  6. Nomascus leucogenys microRNA mir-154
  7. Pan troglodytes microRNA mir-154
  8. Papio anubis microRNA mir-154
2D structure Publications