Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-607 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-607 precursor URS0000722917_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-607: Hsa-mir-607 is an intergenic microRNA (miRNA) that has been found to be underexpressed in extracellular vesicles (EVs) from patients with Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS) compared to healthy controls (HCs) [PMC7005890]. This miRNA has been associated with various biological processes and diseases, including neuropsychiatric and neurodegenerative diseases [PMC5776763]. It is also implicated in the regulation of genes within the TruSight Myeloid Sequencing panel, forming pairs with 13 genes [PMC7851519]. In cancer research, hsa-mir-607 has been linked to poor overall survival in cervical squamous cell carcinoma (CESC), highlighting its potential as a prognostic biomarker [PMC7333649]. Additionally, hsa-mir-607 is predicted to interact with circular RNAs such as circ_0088300 and is involved in complex regulatory networks, having a significant number of gene targets within a coexpression network [PMC9461120]. It also appears to co-regulate genes such as PIGK and ITGB1, suggesting its role in cellular processes that could be relevant for cancer progression or other pathologies [PMC9669594]. Despite its underexpression in ME/CFS EVs, hsa-mir-607's broader implications across various diseases underscore its importance for further research into miRNA-based diagnostics and therapeutics.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGCCUAAAGUCACACAGGUUAUAGAUCUGGAUUGGAACCCAGGGAGCCAGACUGCCUGGGUUCAAAUCCAGAUCUAUAACUUGUGUGACUUUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression Publications