Pan troglodytes (chimpanzee) sRNA (ENSPTRG00000042777.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) sRNA (ENSPTRG00000042777.1) URS0000720C15_9598

116 nucleotides
2 databases (ENA, Ensembl)
Found in 5 other species
1. lncRNA
2. lincRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

AAACAUGCCUUUGAAUUGGAAAGCCAGAACUUUUUGCAAAAUAAUUUGAAAAGUUUGUUGAACCUUAAACCUUUCCUGAUGACUCCUUCCUUCUGAACUUAACUCGUUAAAGUUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Gorilla gorilla gorilla sRNA (ENSGGOG00000040293.1)
Homo sapiens (human) sRNA (ENSG00000276494.1)
Pan paniscus sRNA (ENSPPAG00000006303.1)
Pongo abelii (Sumatran orangutan) misc RNA
Saimiri boliviensis boliviensis sRNA (ENSSBOG00000016517.1)