Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) microRNA mir-301 URS000071E3CB_9796

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCUAACGAAUGCUCUGACUUUAUUGCACUACUGUACUUUACAGCUAGCAGUGCAAUAGUAUUGUCAAAGCAUCUGAAAGCAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) microRNA mir-301
  2. Cavia porcellus microRNA mir-301
  3. Chlorocebus sabaeus microRNA mir-301
  4. Dipodomys ordii microRNA mir-301
  5. Fukomys damarensis microRNA mir-301
  6. Gorilla gorilla gorilla microRNA mir-301
  7. Homo sapiens microRNA mir-301
  8. Loxodonta africana (African savanna elephant) microRNA mir-301
  9. Macaca mulatta (Rhesus monkey) microRNA mir-301
  10. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA mir-301
  11. Oryctolagus cuniculus microRNA mir-301
  12. Pan troglodytes microRNA mir-301
  13. Papio anubis (Olive baboon) microRNA mir-301
  14. Pteropus alecto (black flying fox) microRNA mir-301
  15. Tupaia chinensis microRNA mir-301
Publications