Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000031429.1) URS000071C6FC_591936

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUUGCUUUAACAUGGGGGUACCUGCUGUGUGAAACAAAAGUAAGUGCUUCCAUGUUUCAGUGGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Aotus nancymaae microRNA 302c (ENSANAG00000013790.1)
  2. Callithrix jacchus (white-tufted-ear marmoset) microRNA mir-302
  3. Carlito syrichta (Philippine tarsier) microRNA 302c (ENSTSYG00000020227.2)
  4. Cercocebus atys (Sooty mangabey) microRNA 302c (ENSCATG00000019168.1)
  5. Chlorocebus sabaeus (African green monkey) microRNA 302c (ENSCSAG00000025588.1)
  6. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000013036.1)
  7. Gorilla gorilla gorilla miRNA (ENSGGOG00000038345.1, ENSGGOG00000043477.1)
  8. Homo sapiens (human) microRNA hsa-mir-302c precursor
  9. Macaca fascicularis (Crab-eating macaque) microRNA 302c (ENSMFAG00000005206.2)
  10. Macaca mulatta microRNA mml-mir-302c precursor
  11. Macaca nemestrina (Pig-tailed macaque) microRNA 302c (ENSMNEG00000017285.1)
  12. Mandrillus leucophaeus (Drill) microRNA 302c (ENSMLEG00000010007.1)
  13. Nomascus leucogenys microRNA 302c (ENSNLEG00000019438.2)
  14. Oryctolagus cuniculus microRNA ocu-mir-302c precursor
  15. Pan paniscus microRNA 302c (ENSPPAG00000020046.1)
  16. Pan troglodytes ptr-mir-302c (ENSPTRG00000027646.2)
  17. Papio anubis (olive baboon) microRNA 302c (ENSPANG00000005330.3)
  18. Pongo abelii (Sumatran orangutan) microRNA mir-302
  19. Pongo pygmaeus microRNA ppy-mir-302c precursor
  20. Rhinopithecus bieti microRNA 302c (ENSRBIG00000018563.1)
  21. Rhinopithecus roxellana microRNA 302c (ENSRROG00000027517.1)
  22. Saimiri boliviensis boliviensis microRNA 302c (ENSSBOG00000006329.1)
  23. Sciurus vulgaris (Eurasian red squirrel) microRNA 302c (ENSSVLG00005025977.1)
  24. Theropithecus gelada microRNA 302c (ENSTGEG00000003935.1)