v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Notamacropus eugenii tRNA-Lys (TTT) (tRNA-Lys-TTT-4-1) secondary structure diagram

Notamacropus eugenii tRNA-Lys (TTT) (tRNA-Lys-TTT-4-1) URS000071C635_9315

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCUGGGUAGCUCAGUCGGUAGAGCAUCAGACUUUUAAUCUGAGGGUCCAGGGUUCAAGUCCCUGUCCAGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Balaenoptera acutorostrata scammoni tRNA-Lys (TTT) (tRNA-Lys-TTT-6-1)
  2. Bos taurus tRNA-Lys (TTT) (tRNA-Lys-TTT-3-1)
  3. Chlorocebus sabaeus tRNA-Lys (TTT) (tRNA-Lys-TTT-6-1)
  4. Dasypus novemcinctus tRNA-Lys (TTT) (tRNA-Lys-TTT-6-1, tRNA-Lys-TTT-6-2)
  5. Homo sapiens (human) tRNA-Lys (anticodon TTT) 6-1 (TRK-TTT6-1)
  6. Loxodonta africana tRNA-Lys (TTT) (tRNA-Lys-TTT-8-1)
  7. Macaca mulatta tRNA-Lys (TTT) (tRNA-Lys-TTT-4-1, tRNA-Lys-TTT-4-2)
  8. Nomascus leucogenys tRNA-Lys (TTT) (tRNA-Lys-TTT-4-1, tRNA-Lys-TTT-4-2)
  9. Oryctolagus cuniculus tRNA-Lys (TTT) (tRNA-Lys-TTT-5-1)
  10. Otolemur garnettii tRNA-Lys (TTT) (tRNA-Lys-TTT-5-1)
  11. Ovis aries tRNA-Lys (TTT) (tRNA-Lys-TTT-4-1)
  12. Pan troglodytes tRNA-Lys (TTT) (tRNA-Lys-TTT-6-1)
  13. Papio anubis tRNA-Lys (TTT) (tRNA-Lys-TTT-4-1, tRNA-Lys-TTT-4-2)
  14. Pongo abelii tRNA-Lys (TTT) (tRNA-Lys-TTT-5-1)
  15. Tupaia chinensis tRNA
 2D structure