Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Potamilus streckersoni tRNA-Val secondary structure diagram

Potamilus streckersoni tRNA-Val URS000070B37B_2493646

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCCAUAGUGUAGUGGUUAUCACGUCUGCUUUACACGCAGAAGGUCCUGGGUUCGAGCCCCAGUGGAACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 107 other species

  1. Acanthisitta chloris tRNA
  2. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  3. Albula goreensis tRNA-Val
  4. Alligator mississippiensis tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  5. Alligator sinensis (Chinese alligator) tRNA
  6. Amazona aestiva tRNA
  7. Ameiurus melas tRNA-Val
  8. Anguilla anguilla tRNA-Val
  9. Anolis carolinensis tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  10. Apaloderma vittatum tRNA
  11. Aptenodytes forsteri tRNA
  12. Astyanax mexicanus (Mexican tetra) tRNA
  13. Balaenoptera acutorostrata scammoni tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  14. Balearica regulorum gibbericeps tRNA
  15. Callipepla squamata (scaled quail) tRNA
  16. Callithrix jacchus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  17. Callorhinchus milii tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  18. Calypte anna tRNA
  19. Camelus ferus tRNA
  20. Canis lupus familiaris tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  21. Cariama cristata (red-legged seriema) tRNA
  22. Carlito syrichta tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  23. Cavia porcellus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  24. Ceratotherium simum simum tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  25. Charadrius vociferus tRNA
  26. Chelydra serpentina tRNA-Val
  27. Chlamydotis macqueenii tRNA
  28. Chlorocebus sabaeus tRNA-Val (TAC) (tRNA-Val-TAC-2-1, tRNA-Val-TAC-2-2)
  29. Chrysemys picta bellii tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  30. Colinus virginianus (northern bobwhite) tRNA
  31. Columba livia (rock pigeon) partial tRNA-Val
  32. Cricetulus griseus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  33. Cuculus canorus tRNA
  34. Dallia pectoralis tRNA-Val
  35. Danionella translucida tRNA-Val
  36. Danio rerio tRNA-Val (TAC) (tRNA-Val-TAC-4-1)
  37. Dasypus novemcinctus tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  38. Dreissena polymorpha (Zebra mussle) transfer RNA valine (anticodon UAC)
  39. Echinops telfairi tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  40. Egretta garzetta tRNA
  41. Eptesicus nilssonii tRNA-Val
  42. Equus caballus tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  43. Eurypyga helias (sunbittern) tRNA
  44. Felis catus tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  45. Ficedula albicollis tRNA
  46. Gadus morhua tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  47. Gallus gallus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  48. Geospiza fortis tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  49. Gorilla gorilla gorilla tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  50. Homo sapiens (human) tRNA-Val (anticodon TAC) 1-1 (TRV-TAC1-1, TRV-TAC1-2)
  51. Ictidomys tridecemlineatus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  52. Lamprotornis superbus tRNA-OTHER
  53. Latimeria chalumnae tRNA
  54. Lepisosteus oculatus (spotted gar) tRNA
  55. Leptosomus discolor tRNA
  56. Lonchura striata domestica tRNA
  57. Loxodonta africana tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  58. Macaca mulatta tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  59. Manacus vitellinus tRNA
  60. Marmota monax tRNA.Val
  61. Megalops atlanticus tRNA-Val
  62. Meleagris gallopavo tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  63. Melopsittacus undulatus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  64. Merluccius polli tRNA-Val
  65. Merops nubicus tRNA
  66. Mesitornis unicolor tRNA
  67. Mesocricetus auratus tRNA
  68. Monodelphis domestica tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  69. Mus musculus domesticus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  70. Mustela putorius furo tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  71. Mya arenaria (Soft-shell clam) transfer RNA valine (anticodon UAC)
  72. Nipponia nippon (crested ibis) tRNA
  73. Nomascus leucogenys tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  74. Ochotona princeps tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  75. Ophiophagus hannah (king cobra) tRNA
  76. Ornithorhynchus anatinus tRNA-Val (TAC) (tRNA-Val-TAC-1 1 to 3)
  77. Oryctolagus cuniculus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  78. Pangasianodon gigas tRNA-Val
  79. Pangasianodon hypophthalmus tRNA-Val
  80. Pangasius djambal tRNA-Val
  81. Pan troglodytes tRNA-Val (TAC) (tRNA-Val-TAC-11-1)
  82. Papio anubis tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  83. Patagioenas fasciata monilis tRNA
  84. Pelobates cultripes tRNA.Val
  85. Petromyzon marinus tRNA-Val (TAC) (tRNA-Val-TAC-3-1)
  86. Phaethon lepturus tRNA
  87. Phoenicopterus ruber ruber tRNA
  88. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  89. Dryobates pubescens tRNA
  90. Podarcis lilfordi tRNA.Val
  91. Pongo abelii tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-3)
  92. Procavia capensis tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  93. Saimiri boliviensis boliviensis tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  94. Salmo salar (Atlantic salmon) tRNA
  95. Sarcophilus harrisii tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  96. Scleropages formosus tRNA
  97. Sphaerodactylus townsendi tRNA-Val
  98. Struthio camelus australis tRNA
  99. Sus scrofa tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  100. Taeniopygia guttata tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  101. Tinamus guttatus tRNA
  102. Trichechus manatus latirostris tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  103. Tupaia chinensis (Chinese tree shrew) tRNA
  104. Tursiops truncatus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  105. Vicugna pacos tRNA-Val (TAC) (tRNA-Val-TAC-1 1 to 3)
  106. Xenopus laevis tRNA
  107. Xenopus tropicalis tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
2D structure