v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Macaca mulatta (Macaque) small nucleolar RNA, C/D box 92 (ENSMMUG00000040148.2) secondary structure diagram

Macaca mulatta (Macaque) small nucleolar RNA, C/D box 92 (ENSMMUG00000040148.2) URS0000706C1B_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGCUGUGAUGAUGCCUUAAUAUUGUGGUUUCGACUCACUGAGAGUAAAAUGAGGACCUACAAUUCCUUGGCUGUGUCUGAGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Chlorocebus sabaeus (African green monkey) small nucleolar RNA, C/D box 92 (ENSCSAG00000027114.1)
  2. Colobus angolensis palliatus snoRNA (ENSCANG00000013419.1)
  3. Gorilla gorilla gorilla (Western Lowland Gorilla) small nucleolar RNA, C/D box 92 (ENSGGOG00000038701.1)
  4. Homo sapiens small nucleolar RNA, C/D box 92 (ENSG00000264994.1)
  5. Macaca fascicularis (Crab-eating macaque) small nucleolar RNA, C/D box 92 (ENSMFAG00000007969.2)
  6. Macaca nemestrina snoRNA (ENSMNEG00000002304.1)
  7. Mandrillus leucophaeus small nucleolar RNA, C/D box 92 (ENSMLEG00000010013.1)
  8. Nomascus leucogenys small nucleolar RNA, C/D box 92 (ENSNLEG00000020781.2)
  9. Pan paniscus (bonobo) small nucleolar RNA, C/D box 92 (ENSPPAG00000021197.1)
  10. Pan troglodytes small nucleolar RNA, C/D box 92 (ENSPTRG00000039714.2)
  11. Papio anubis small nucleolar RNA, C/D box 92 (ENSPANG00000027182.3)
  12. Piliocolobus tephrosceles snoRNA (ENSPTEG00000008317.1)
  13. Pongo abelii small nucleolar RNA, C/D box 92 (ENSPPYG00000034733.1)
  14. Rhinopithecus bieti (Black snub-nosed monkey) small nucleolar RNA, C/D box 92 (ENSRBIG00000014290.1)
  15. Rhinopithecus roxellana small nucleolar RNA, C/D box 92 (ENSRROG00000008473.1)
  16. Theropithecus gelada small nucleolar RNA SNORD53/SNORD92 (ENSTGEG00000024932.1)
 2D structure Publications