v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rhinopithecus bieti (Black snub-nosed monkey) microRNA 134 (ENSRBIG00000011109.1) secondary structure diagram

Rhinopithecus bieti (Black snub-nosed monkey) microRNA 134 (ENSRBIG00000011109.1) URS000070357E_61621

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAGGGUGUGUGACUGGUUGACCAGAGGGGCGUGCACUGUGUUCACCCUGUGGGCCACCUAGUCACCAACCCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Callithrix jacchus microRNA mir-134
  2. Cebus imitator (Panamanian white-faced capuchin) microRNA 134 (ENSCCAG00000003787.1)
  3. Cercocebus atys (Sooty mangabey) microRNA 134 (ENSCATG00000015715.1)
  4. Chlorocebus sabaeus microRNA mir-134
  5. Colobus angolensis palliatus miRNA (ENSCANG00000018499.1)
  6. Macaca mulatta microRNA mml-mir-134 precursor
  7. Macaca nemestrina mne-mir-134 (ENSMNEG00000004297.1)
  8. Mandrillus leucophaeus microRNA 134 (ENSMLEG00000016574.1)
  9. Papio anubis (Olive baboon) microRNA mir-134
  10. Rhinopithecus roxellana microRNA 134 (ENSRROG00000005139.1)
  11. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 134 (ENSSBOG00000019796.1)
 2D structure