Homo sapiens (human) small nucleolar RNA, C/D box 50B (ENSG00000275072.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 50B (ENSG00000275072.1) URS00006F8A66_9606

70 nucleotides
6 databases (ENA, Ensembl, GeneCards, Rfam, snoDB, snOPY)
Found in 7 other species
72 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD50B: SNORD50B is a long non-coding RNA (lncRNA) that has been identified as a probe mapping to SNHG5, SNORD50A, and SNORD50B [PMC7554339]. A study has shown that both SNORD50A and SNORD50B play a role in activating the K-Ras/B-Raf-MEK-ERK pathway, which in turn facilitates the proliferation of tumor cells [PMC7550692].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AAUCAAUGAUGAAACCUAUCCCGAAGCUGAUAACCUGAAGAAAAAUAAGUACGGAUUCGGCUUCUGAGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.