v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Papio anubis (Olive baboon) microRNA mir-770 URS00006F7B40_9555

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAGGAGCCACCUUCCGAGCCUCCAGUACCACGUGUCAGGGCCACAUGAGCUGGGCCUCGUGGGCCUGAUGUGGUGCUGGGGCCUCAGGGGUCUGCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Chlorocebus sabaeus microRNA mir-770
  2. Gorilla gorilla gorilla microRNA mir-770
  3. Homo sapiens microRNA mir-770
  4. Macaca mulatta microRNA mir-770
  5. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA mir-770
  6. Pan troglodytes (chimpanzee) microRNA mir-770
  7. Pongo abelii (Sumatran orangutan) microRNA mir-770
 Publications