v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) microRNA gga-mir-190a precursor URS00006F2A5E_9031

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGCAGGACUCUGUGUGAUAUGUUUGAUAUAUUAGGUUGUUAUUUAAUCCAACUAUAUAUCAAACAUAUUCCUACAGUGUCCUGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Acanthisitta chloris microRNA mir-190
  2. Alligator mississippiensis (American alligator) microRNA mir-190
  3. Amazona aestiva microRNA mir-190
  4. Anas platyrhynchos microRNA mir-190
  5. Aptenodytes forsteri microRNA mir-190
  6. Balearica regulorum gibbericeps microRNA mir-190
  7. Callipepla squamata (scaled quail) microRNA mir-190
  8. Calypte anna (Anna's hummingbird) microRNA mir-190
  9. Antrostomus carolinensis microRNA mir-190
  10. Cariama cristata (red-legged seriema) microRNA mir-190
  11. Cathartes aura microRNA mir-190
  12. Chaetura pelagica (chimney swift) microRNA mir-190
  13. Charadrius vociferus microRNA mir-190
  14. Chlamydotis macqueenii microRNA mir-190
  15. Colinus virginianus (northern bobwhite) microRNA mir-190
  16. Colius striatus microRNA mir-190
  17. Columba livia microRNA mir-190
  18. Corvus brachyrhynchos microRNA mir-190
  19. Egretta garzetta microRNA mir-190
  20. Eurypyga helias (sunbittern) microRNA mir-190
  21. Ficedula albicollis microRNA mir-190
  22. Fulmarus glacialis (northern fulmar) microRNA mir-190
  23. Gavia stellata microRNA mir-190
  24. Haliaeetus albicilla (white-tailed eagle) microRNA mir-190
  25. Latimeria chalumnae microRNA 190a (ENSLACG00000019900.1)
  26. Leptosomus discolor microRNA mir-190
  27. Manacus vitellinus (golden-collared manakin) microRNA mir-190
  28. Meleagris gallopavo (turkey) microRNA mir-190
  29. Merops nubicus microRNA mir-190
  30. Mesitornis unicolor microRNA mir-190
  31. Nestor notabilis microRNA mir-190
  32. Nipponia nippon (crested ibis) microRNA mir-190
  33. Opisthocomus hoazin microRNA mir-190
  34. Pelecanus crispus microRNA mir-190
  35. Phaethon lepturus microRNA mir-190
  36. Phalacrocorax carbo (great cormorant) microRNA mir-190
  37. Phoenicopterus ruber ruber microRNA mir-190
  38. Pterocles gutturalis (yellow-throated sandgrouse) microRNA mir-190
  39. Pygoscelis adeliae microRNA mir-190
  40. Tauraco erythrolophus (red-crested turaco) microRNA mir-190
  41. Tinamus guttatus microRNA mir-190
  42. Tyto alba microRNA mir-190
 Publications