v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gorilla gorilla gorilla (western lowland gorilla) U7 small nuclear RNA secondary structure diagram

Gorilla gorilla gorilla (western lowland gorilla) U7 small nuclear RNA URS00006F1E8E_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAGUGUUAUAGCUCUUUUAGUUUGUCUAGCAGGUUUUUUGGAUUUUACCAGAAAGCCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Chlorocebus sabaeus U7 small nuclear RNA
  2. Homo sapiens U7 small nuclear RNA
  3. Nomascus leucogenys U7 small nuclear RNA
  4. Pongo abelii U7 small nuclear RNA (ENSPPYG00000027734.2)
 2D structure Publications