Gorilla gorilla gorilla (Western Lowland Gorilla) 5S ribosomal RNA (ENSGGOG00000029692.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla (Western Lowland Gorilla) 5S ribosomal RNA (ENSGGOG00000029692.2) URS00006E9BE0_9595

105 nucleotides
2 databases (Ensembl, Rfam)
Found in 1 other species
122 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UUCUAUGGCCAUACCACCCUGAAUGUGCCUGAUCUUGGAAGCUAAGCAGGGUAGGGCCUGGUUAGUACUUGGGUGGAAGAAAUAUUAGUUAAAUUGCCAUGGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Homo sapiens 5S ribosomal RNA

2D structure

Publications