Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 114-9 (SNORD114-9) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 114-9 (SNORD114-9) URS00006DFE33_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD114-9: SNORD114-9 is a snoRNA (small nucleolar RNA) located in the imprinted DLK1-DIO3 cluster, similar to the SNORD cluster in the Prader-Willi/Angelman region [PMC5850272]. In a study, seven CpGs in the proximal promoters of ATG4C and SNORD114-9 were not associated with assisted reproductive technology (ART) or intracytoplasmic sperm injection (ICSI) [PMC7801794]. In another study, SNORD114-9 was identified as one of the snoRNAs that were downregulated in adrenocortical carcinoma samples [PMC5607708]. The methylation status of SNORD114-9 was validated using bisulfite sequencing and it was found that hypomethylation of SNORD114-9 correlated with high gene expression in tumor samples [PMC5796982]. The expression levels of DLK1-DIO3 cluster components, including SNORD114-9, were analyzed using quantitative PCR [PMC5796982]. In a study on children conceived through assisted reproductive techniques, including ICSI and IVF, differential methylation of ATG4C and SNORD114-9 was observed. The methylation levels of CpG 3 in SNORD114-9 differed significantly between ICSI children and controls [PMC5850272]. The pyrosequencing assays targeting CpGs in ATG4C and SNORD114-9 provided more accurate measurements of regional methylation levels compared to arrays [PMC5850272]. It is speculated that altered methylation patterns in ATG4C and decreased methylation in SNORD114-9 may modulate cancer susceptibility [PMC5850272]. References: [PMC7801794] [PMC7461500] [PMC5607708] [PMC5796982] [PMC5850272]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAUCGAUGAUGACUGCUGGUGGCGUAUGAGUCUUACAUGAUGAAUACGUGUCUGGAACUCUGAGGUCCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications